View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0586_low_68 (Length: 262)
Name: NF0586_low_68
Description: NF0586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0586_low_68 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 30723526 - 30723758
Alignment:
| Q |
1 |
tggcatcttgaaacgaaatgtaaaaaagctttctatcactacatatttagagctacccttctctgcttatacatcacatattctttttaattactcttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30723526 |
tggcatcttgaaacgaaatgtaaaaaagctttctatcactacatatttagagctacccttctctgcttatacatcacatattctttttaattactcttat |
30723625 |
T |
|
| Q |
101 |
atgttagaagaattggtgcttgagatgcattgtggttttatcaaagttcctccctgcagttcttattatacttgtagttttggaagcctaaatgttatca |
200 |
Q |
| |
|
| ||||||||||||||| |||||||||| |||| ||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30723626 |
aagttagaagaattggttcttgagatgcgttgttgttctatcaaagttcctccctgcagttcttatgatacttgtagttttggaagcctaaatgttatca |
30723725 |
T |
|
| Q |
201 |
agttgtgtggaattatgttcaccatggacgaat |
233 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
30723726 |
agttgtgtggaattatgttcaccatggatgaat |
30723758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 938 times since January 2019
Visitors: 3837