View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0586_low_72 (Length: 253)
Name: NF0586_low_72
Description: NF0586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0586_low_72 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 49 - 226
Target Start/End: Complemental strand, 34784853 - 34784677
Alignment:
Q |
49 |
attgttgcaccatttttctaagttatgatctgttttaggtcttccataaatggttacgggttttgtgcttaaaatatgtctaattaaccccgattctaaa |
148 |
Q |
|
|
|||||||||||||||||||||||||| |||||||||| || | ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
34784853 |
attgttgcaccatttttctaagttattgtctgttttagatcctacataaatggttacgg-ttttgtgcttaaaatatgtctaattaacctcgattctaaa |
34784755 |
T |
 |
Q |
149 |
cgacgtaaaactttgtgtattgaagaaacaacatcaattatgttatattatatacttggaaaattattggtaataatg |
226 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34784754 |
cgacgtaaaactttgtgtattgaagaaacaacatcaattatgttatattatatacttggaaaattattggtaataatg |
34784677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 912 times since January 2019
Visitors: 3837