View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0586_low_73 (Length: 252)
Name: NF0586_low_73
Description: NF0586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0586_low_73 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 12 - 202
Target Start/End: Complemental strand, 39507436 - 39507245
Alignment:
| Q |
12 |
atgaaaagac-gctaaaatttcttacccacttaattgctcaagagttttcttatcagatttatcaatcacatcagcaagtcttttgagaacattgtagcc |
110 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||||| |||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39507436 |
atgaaaagacagctaaaatttcttacccgcttaattgctctagagcattcttatcagacttatcaatcacatcagcaagtcttttgagaacattgtagcc |
39507337 |
T |
 |
| Q |
111 |
ctaaacaatttacaaaacataaatggttattcaatggacaagataaccaaaacaagcaagtagaaaagttgtcacagtgcccaaagagctga |
202 |
Q |
| |
|
||||| |||| ||||| ||||| ||||||| |||||||||||| |||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
39507336 |
ctaaataattagagaaacaaaaatgattattcagtggacaagataagcaaaacaagcaagttgaaaagttgtcacagtgccaaaagagctga |
39507245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 28 - 107
Target Start/End: Complemental strand, 8880599 - 8880520
Alignment:
| Q |
28 |
atttcttacccacttaattgctcaagagttttcttatcagatttatcaatcacatcagcaagtcttttgagaacattgta |
107 |
Q |
| |
|
|||||||||| ||| |||||| |||| |||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8880599 |
atttcttaccggattatttgctctagagctttcctatcaaatttatcaatcacatcagcaagtcttttgagaacattgta |
8880520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University