View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0586_low_74 (Length: 252)
Name: NF0586_low_74
Description: NF0586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0586_low_74 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 30 - 252
Target Start/End: Original strand, 6220579 - 6220801
Alignment:
| Q |
30 |
ttctagaggctaaattgtctctaatacaatgaaggaaagactcatcatgagcattacaccaagtgtaaagacaattaagatccaagtacatccnnnnnnn |
129 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
6220579 |
ttctagaggctaaatagtctctaatacaatgaaggaaagactcatcatgagcattacaccaagtgtaaagacaattaagatccaagtacacccaaaacaa |
6220678 |
T |
|
| Q |
130 |
ntctaattaagtacgtaatataannnnnnnaacaaagcaagatggaatattcaacattaatttcgagaggggtatgtccatgtctacgaa-attttcaca |
228 |
Q |
| |
|
|||||||||||||| ||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6220679 |
atctaattaagtacgcaatat-ttttttttaacaaatcaagatggaatattcaacattaatttcgagaggggtatgtccatgtctacgaatattttcaca |
6220777 |
T |
|
| Q |
229 |
atgcgataataattcaaatcccac |
252 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
6220778 |
atgcgataataattcaaatcccac |
6220801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 717 times since January 2019
Visitors: 3837