View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0586_low_76 (Length: 251)
Name: NF0586_low_76
Description: NF0586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0586_low_76 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 7 - 251
Target Start/End: Complemental strand, 6221092 - 6220845
Alignment:
| Q |
7 |
tcgaagaatatataaatttttacaattgatctcaattgttaatgtattgc---taaaaagaattccttcaagaaaacctgagtttaattcataggtgaac |
103 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6221092 |
tcgaacaaaatataaatttttacaattgatctcaattgttaatgtattccacctaaaaagaattccttcaagaaaacctgagtttaattcataggtgaac |
6220993 |
T |
 |
| Q |
104 |
tattcattgtcggattgtacaaacaaaaagtatactaaagcttatagtagatgaagcatgttctgattatttattttttctaacccactgtaataattta |
203 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6220992 |
cattcattgtcggattgtacaaacaaaaaatatactaaagcttatagtagatgaagcatgttctgattatttattttttctaacccactgtaataattta |
6220893 |
T |
 |
| Q |
204 |
ttttttcaatccctctcttcactcacaaaaaccacatggactgcactc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6220892 |
ttttttcaatccctctcttcactcacaaaaaccacatggactgcactc |
6220845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University