View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0586_low_77 (Length: 251)

Name: NF0586_low_77
Description: NF0586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0586_low_77
NF0586_low_77
[»] chr3 (2 HSPs)
chr3 (1-86)||(47562907-47562992)
chr3 (160-222)||(47563064-47563126)


Alignment Details
Target: chr3 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 86
Target Start/End: Original strand, 47562907 - 47562992
Alignment:
1 agattttataatgcctcatggtgtgagttaccaaataagaaccctattgtaaatttatgcaagatttaaagaaatggatacaatgt 86  Q
    ||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
47562907 agattttgtaatgcctcgtggtgtgagttaccaaataagaaccctattgtaaatttatgcaaaatttaaagaaatggatacaatgt 47562992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 160 - 222
Target Start/End: Original strand, 47563064 - 47563126
Alignment:
160 aagaacaagattataacatggtttttcatacatataaaaatctagaaaggaggatgaggagga 222  Q
    ||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
47563064 aagaataagattataacatggtttttcatatatataaaaatctagaaaggaggatgaggagga 47563126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University