View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0586_low_78 (Length: 250)

Name: NF0586_low_78
Description: NF0586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0586_low_78
NF0586_low_78
[»] chr2 (1 HSPs)
chr2 (107-249)||(39414038-39414182)


Alignment Details
Target: chr2 (Bit Score: 74; Significance: 5e-34; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 107 - 249
Target Start/End: Original strand, 39414038 - 39414182
Alignment:
107 tacaggtgtgatgattttgggctgagtc--tattttttgatacatg-atgtgccgtgtcactgaaccaatgccaactcatggtcnnnnnnnatgacaatg 203  Q
    ||||||||||||||||||||||||||||  ||||||| || || || ||||||||||||||||||||||||||||||| |||||       |||||||||    
39414038 tacaggtgtgatgattttgggctgagtcaatatttttggacacgtggatgtgccgtgtcactgaaccaatgccaactcgtggtctttttcgatgacaatg 39414137  T
204 ttaacgagggactaaaatataaatgggttcaaatatcataggggta 249  Q
    |||| |||||||| |||||||||||||||||||||| |||||||||    
39414138 ttaatgagggact-aaatataaatgggttcaaatattataggggta 39414182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University