View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0586_low_82 (Length: 228)
Name: NF0586_low_82
Description: NF0586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0586_low_82 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 11 - 228
Target Start/End: Complemental strand, 25873641 - 25873423
Alignment:
Q |
11 |
actaggtaaaagtagtacacacaccatacgttctacaaacaattaggagaaaatatgggcgagatcattaacaaacaatttcacacaacctttttaaatt |
110 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25873641 |
actaggtaaaagcagtacacacaccatacgttctacaaacaattaggagaaaatatgggtaagatcattaacaaacaatttcacacaacctttttaaatt |
25873542 |
T |
 |
Q |
111 |
ggacatcaccttacacaaagatacaaaacactgcatgaaattgttgatgaagttc-agtctaaagattggtcattgatcgagtataaagtaactgaggtg |
209 |
Q |
|
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||| |||| |||||||||||||||||||| |
|
|
T |
25873541 |
ggacatcaccttacacaaagatacaaaacactccatgaaattgttgatgaagttcgggtctaaagattggtcactgattgagtataaagtaactgaggtc |
25873442 |
T |
 |
Q |
210 |
tcaattgaattgcataatt |
228 |
Q |
|
|
||||||||||||||||||| |
|
|
T |
25873441 |
tcaattgaattgcataatt |
25873423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1480 times since January 2019
Visitors: 3846