View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0586_low_84 (Length: 204)

Name: NF0586_low_84
Description: NF0586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0586_low_84
NF0586_low_84
[»] chr5 (1 HSPs)
chr5 (1-126)||(6081918-6082043)


Alignment Details
Target: chr5 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 1 - 126
Target Start/End: Complemental strand, 6082043 - 6081918
Alignment:
1 tagaacatagaagttgagaaagtaaagagaacaatgaatatgataacgtgttgtgcttgatatctcaccgacgctctgagttcaaggaaaatgactcaca 100  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
6082043 tagaacatagaagttgagaaagtgaagagaacaatgaatatgataacgtgttgtgtttgatatctcaccgacgctctgagttcaaggaaaatgactcaca 6081944  T
101 ctcctcaactaacaactatctctgct 126  Q
    ||||||||||||||||||||||||||    
6081943 ctcctcaactaacaactatctctgct 6081918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1408 times since January 2019
Visitors: 3846