View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0587_high_20 (Length: 228)
Name: NF0587_high_20
Description: NF0587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0587_high_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 47040978 - 47041203
Alignment:
| Q |
1 |
cgtgagtaaattatttgggagatatatcatttttcattttagaacttgtgtaaccaaagtcttaaaaatataaaaattgatatttgttccaatgtaaatt |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
47040978 |
cgtgagtaaattattcgggagatatatcatttttcattttagaacttgtgtaaccaaagtcttaaaaatataaaaattgatatttgtttcaatgtaaatt |
47041077 |
T |
|
| Q |
101 |
tttcttctttttattagtgaag----nnnnnnnnngtgtgtaacaaatggggttgcagattaggaaaattgttttccttgattttagaaatatgattatg |
196 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47041078 |
tttcttctttttattagtgaagtttttttttttttgtgtgtaacaaatggggttgcagattaggaaaattgttttccttgattttagaaatacgattatg |
47041177 |
T |
|
| Q |
197 |
tctcctattttatgtggtggagaaca |
222 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
47041178 |
tctcctattttatgtggtggagaaca |
47041203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1144 times since January 2019
Visitors: 3840