View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0587_high_21 (Length: 227)
Name: NF0587_high_21
Description: NF0587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0587_high_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 140
Target Start/End: Complemental strand, 32936707 - 32936574
Alignment:
Q |
1 |
aacttcgtccacccttatgcttagcgtgggtcctagactcaattctcacattgtcatctttaaccttaaccaactctaatattgtatcaaatgagcttga |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| ||||| |||||||||||||||| |
|
|
T |
32936707 |
aacttcgtccacccttatgcttagcgtgggtcctagactcaattctcacattgtcgtct------ttaaccaactctgatattatatcaaatgagcttga |
32936614 |
T |
 |
Q |
101 |
atctaactctcaaaagttaactcataaaatgatgatgtcc |
140 |
Q |
|
|
|||||||||||| |||||||||||| |||||||| ||||| |
|
|
T |
32936613 |
atctaactctcagaagttaactcattaaatgatggtgtcc |
32936574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University