View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0587_high_8 (Length: 317)
Name: NF0587_high_8
Description: NF0587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0587_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 6e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 124 - 289
Target Start/End: Original strand, 5101788 - 5101959
Alignment:
| Q |
124 |
ccctttaaaaataaatttaggggtttgggccagctaggcttgagcatggttttagaatccattta-----aagcttcgttgagtctagggttgtttgttt |
218 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5101788 |
ccctttaaaaataaatttaggg-tttgggccagctaggcttgagcatggttttagaatccatttataataaagcttcgttgagtctagggttgtttgttt |
5101886 |
T |
|
| Q |
219 |
tgttgtgtagcatat--tttcataggagtgagcgaaggattaacaatggcagccgctgcaacaggttcatatt |
289 |
Q |
| |
|
|||| |||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5101887 |
tgttttgtagcatatattttcataggaatgagcgaaggattaacaatggcagccgctgcaacaggttcatatt |
5101959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 196 - 265
Target Start/End: Original strand, 5106108 - 5106177
Alignment:
| Q |
196 |
gttgagtctagggttgtttgttttgttgtgtagcatattttcataggagtgagcgaaggattaacaatgg |
265 |
Q |
| |
|
||||||| ||||||| || |||||| ||| ||||| |||||||| ||||||||||| |||||||||||| |
|
|
| T |
5106108 |
gttgagtttagggtttttgtttttgtcgtggagcatgttttcatacgagtgagcgaacgattaacaatgg |
5106177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 85; Significance: 2e-40; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 148 - 289
Target Start/End: Original strand, 2576123 - 2576266
Alignment:
| Q |
148 |
ttgggccagctaggcttgagcatggttttagaatccattta--aagcttcgttgagtctagggttgtttgttttgttgtgtagcatattttcataggagt |
245 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| ||||| |||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2576123 |
ttgggccagctaggcttgagcacgattttagaatcgatttataaagctttgttgagtctagggttgttgtttttgttgtgtagcatattttcataggagt |
2576222 |
T |
|
| Q |
246 |
gagcgaaggattaacaatggcagccgctgcaacaggttcatatt |
289 |
Q |
| |
|
||||||| ||||| | ||||||| |||||||||| |||||||| |
|
|
| T |
2576223 |
gagcgaacgattatccatggcagtggctgcaacagtttcatatt |
2576266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2077 times since January 2019
Visitors: 3811