View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0587_low_17 (Length: 323)
Name: NF0587_low_17
Description: NF0587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0587_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 72 - 232
Target Start/End: Original strand, 37709277 - 37709437
Alignment:
| Q |
72 |
gaagaatatgtgggcaatggaagcagtgttaagcgacttgatttttgaagtgttaattggataaatagtcttttacgaaccttgtactttcagaaagtgt |
171 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37709277 |
gaagaacatgtgggcaatggaagcagtgttaagcgacttgatttttgaagtgttaattggataaatagtcttttacgaaccttgtactttcagaaagtgt |
37709376 |
T |
|
| Q |
172 |
gaatctcatgaagttttctacttggaactcgatagtgaattctcttcgtggtgtaatatgt |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37709377 |
gaatctcatgaagttttctacttggaactcgatagtgaattctcttcgtggtgtaatatgt |
37709437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 249 times since January 2019
Visitors: 3833