View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0587_low_18 (Length: 321)
Name: NF0587_low_18
Description: NF0587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0587_low_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 91 - 271
Target Start/End: Complemental strand, 6713877 - 6713699
Alignment:
Q |
91 |
tgttgattgtgcccctatgttttgatgattcctcgggcctttagcaggatattgagtttgttgaatctcatggttcttgattttagttgcatcgtttttg |
190 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
6713877 |
tgttgattgtgcccctatgttttgatgattcctcgggcctttagcaggatattgagtttgttgaatc--atggttcttgattttagttgcatcgtttttg |
6713780 |
T |
 |
Q |
191 |
cttttccttttgacattgcattggatatatgtatctcttgtactcaatttctttctatatatatgatttgatttgccactc |
271 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6713779 |
cttttccttttgacattgcattggatatatgtatctcttgtactcaatttctttctatatatatgatttgatttgccactc |
6713699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 6714015 - 6713925
Alignment:
Q |
1 |
tttttatccaagaacaagatttaagggtggannnnnnnaacctcattagtagtgaaaccctaactcttatggaggataatgtgtcttgggt |
91 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
6714015 |
tttttatccaagaacaagatttaagggtggatttttttaacctcattagtagttaaaccctaactcttatggaggataatgtgtcttgggt |
6713925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University