View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0587_low_25 (Length: 302)
Name: NF0587_low_25
Description: NF0587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0587_low_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 21 - 295
Target Start/End: Complemental strand, 21219221 - 21218947
Alignment:
| Q |
21 |
acatcatcatactcctggaatcttgattatattttactaaatagttgttttgtgcaactatagtacttgattcactgattacactatcgtacttttgatg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21219221 |
acatcatcatactcctggaatcttgattatattttactaaatagttgttttgtgcaactatagtacttgattcactgattacactatcgtacttttgatg |
21219122 |
T |
 |
| Q |
121 |
agatcttttagtatacagcaatgtttgactgatttgtcagctgtgctgatatatcctggttaatggatcattttatttattgttttgtgtgtatgtatgt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
21219121 |
agatcttttagtatacagcaatgtttgactgatttgtcaactgtgctgatatatcctggttaatggatcattttatttattgttctgtgtgtatgtatgt |
21219022 |
T |
 |
| Q |
221 |
atcgattctataagattttgtgtcattgtaatatacatccctaatgtaattatttgttttttgtcttctgtgctc |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21219021 |
atcgattctataagattttgtgtcattgtaatatacatccctaatgtaattatttgttttttgtcttctgtgctc |
21218947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University