View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0587_low_26 (Length: 271)
Name: NF0587_low_26
Description: NF0587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0587_low_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 52 - 245
Target Start/End: Original strand, 5863672 - 5863865
Alignment:
Q |
52 |
ttaatagtagtttgtttgttggcaagacaatattataaaacaagaactaggtagagtactctattgaaaactgtggaaattctcataaagaaaaagagag |
151 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5863672 |
ttaatagtagtttgtttgttggcaagacaatattataaaacaagaactaggtagagtactctattgaaaactgtggaaattctcataaagaaaaagagag |
5863771 |
T |
 |
Q |
152 |
ttggaactgaacattaaaaatgacaaagttaagttcaacttatgggaaggttcatcttctttctgtttttcttttactatcaaatattttcttt |
245 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |||| |
|
|
T |
5863772 |
ttggaagtgaacattaaaaatgacaaagttaagttcaacttatgggaaggttcatcttctttctattttgcttttactatcaaatatttgcttt |
5863865 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 125 - 245
Target Start/End: Original strand, 5856953 - 5857069
Alignment:
Q |
125 |
tggaaattctcataaagaaaaagagagttggaactgaacattaaaaatgacaaagttaagttcaacttatgggaaggttcatcttctttctgtttttctt |
224 |
Q |
|
|
|||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| ||||||||||||||||| | ||||||||||||||||||| |
|
|
T |
5856953 |
tggaaattctcataaagaaaaagagagt-ggaagtgaacattaaaaatgacaaagtttagttcaacttatgggaaaat---tcttctttctgtttttctt |
5857048 |
T |
 |
Q |
225 |
ttactatcaaatattttcttt |
245 |
Q |
|
|
|||||||||||||||| |||| |
|
|
T |
5857049 |
ttactatcaaatatttccttt |
5857069 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University