View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0587_low_27 (Length: 266)
Name: NF0587_low_27
Description: NF0587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0587_low_27 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 30 - 239
Target Start/End: Original strand, 28612794 - 28613003
Alignment:
Q |
30 |
ttgacatttctttacattaaaattcaaaaccaaatcgtacttttgatatcaatgttaatgtcctctgtcacatttgcttgtaacatacaatgttacttgt |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28612794 |
ttgacatttctttacattaaaattcaaaaccaaatcgtacttttgatatcaatgttaatgtcctctgtcacatttgcttgtaacatacaatgttacttgt |
28612893 |
T |
 |
Q |
130 |
tcctttacaacactttgacattctcttgggtttgttcaatatatgattttgtaggaaaaaagggaaatgaacattaattaaaaggnnnnnnnttcaaagc |
229 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
28612894 |
tcctttacaacactttgacattctcttgggtttgtccaatatatgattttgtaggaaaaaagggaaatgaacattaattaaaaggaaaaaaattcaaagc |
28612993 |
T |
 |
Q |
230 |
ctgtggccta |
239 |
Q |
|
|
|||||||||| |
|
|
T |
28612994 |
ctgtggccta |
28613003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 442 times since January 2019
Visitors: 3834