View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0587_low_31 (Length: 250)
Name: NF0587_low_31
Description: NF0587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0587_low_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 47040981 - 47040744
Alignment:
Q |
1 |
cacgaatccatcccgaaggtttagatcaatttggttggcattgattactgctattttcccaccatgttttccgggcgatacaagattatgattggttgat |
100 |
Q |
|
|
||||||||| ||||||||||||| ||||||||| ||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
T |
47040981 |
cacgaatccttcccgaaggtttaaatcaatttgattggcattgattattgctattttcccaccatgttttccgggcaatacaagattatgattgattgat |
47040882 |
T |
 |
Q |
101 |
gaaaaatcttgaagcattcggaacaaaatgtgtcgctatatttagcaatgctcttctaaaatatatatatcatatttattttttaaactagtggtcaaag |
200 |
Q |
|
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
47040881 |
gaaaaatcttgaagcattcgggacaaaatgtgtcgctatatttagcaatgctcttctaaaatatatatatcgtatttattttttaaactagt-gtcaaag |
47040783 |
T |
 |
Q |
201 |
aaatttgttaacatttcctttataaaaattatttatatt |
239 |
Q |
|
|
| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
47040782 |
acatttgttaacatttcctttataaaaattatttatatt |
47040744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 134
Target Start/End: Original strand, 41579980 - 41580065
Alignment:
Q |
49 |
tgctattttcccaccatgttttccgggcgatacaa-gattatgattggttgatgaaaaatcttgaagcattcggaacaaaatgtgtc |
134 |
Q |
|
|
||||||||||| |||||||||| || | |||||| |||||| ||| |||||||||||||| |||| ||||||| ||||||| |||| |
|
|
T |
41579980 |
tgctattttcc-accatgttttttggacaatacaaagattataattcgttgatgaaaaatcgtgaaccattcgggacaaaatttgtc |
41580065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University