View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0587_low_35 (Length: 228)
Name: NF0587_low_35
Description: NF0587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0587_low_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 47040978 - 47041203
Alignment:
Q |
1 |
cgtgagtaaattatttgggagatatatcatttttcattttagaacttgtgtaaccaaagtcttaaaaatataaaaattgatatttgttccaatgtaaatt |
100 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
47040978 |
cgtgagtaaattattcgggagatatatcatttttcattttagaacttgtgtaaccaaagtcttaaaaatataaaaattgatatttgtttcaatgtaaatt |
47041077 |
T |
 |
Q |
101 |
tttcttctttttattagtgaag----nnnnnnnnngtgtgtaacaaatggggttgcagattaggaaaattgttttccttgattttagaaatatgattatg |
196 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
47041078 |
tttcttctttttattagtgaagtttttttttttttgtgtgtaacaaatggggttgcagattaggaaaattgttttccttgattttagaaatacgattatg |
47041177 |
T |
 |
Q |
197 |
tctcctattttatgtggtggagaaca |
222 |
Q |
|
|
|||||||||||||||||||||||||| |
|
|
T |
47041178 |
tctcctattttatgtggtggagaaca |
47041203 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University