View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0587_low_40 (Length: 210)

Name: NF0587_low_40
Description: NF0587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0587_low_40
NF0587_low_40
[»] chr8 (3 HSPs)
chr8 (1-46)||(37182229-37182274)
chr8 (1-46)||(37193361-37193406)
chr8 (100-132)||(3193523-3193555)
[»] chr3 (1 HSPs)
chr3 (1-46)||(42036796-42036841)
[»] chr2 (1 HSPs)
chr2 (100-134)||(17854474-17854508)


Alignment Details
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 37182229 - 37182274
Alignment:
Q  1 attggctttgaacgtgcattagcggtcactcaccgcacaaacaaac 46  Q
    |||||||||||||||||| ||||| |||||||||||||||||||||    
T  37182229 attggctttgaacgtgcagtagcgatcactcaccgcacaaacaaac 37182274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 37193361 - 37193406
Alignment:
Q  1 attggctttgaacgtgcattagcggtcactcaccgcacaaacaaac 46  Q
    |||||||||||||||||| ||||| |||||||||||||||||||||    
T  37193361 attggctttgaacgtgcagtagcgatcactcaccgcacaaacaaac 37193406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 100 - 132
Target Start/End: Original strand, 3193523 - 3193555
Alignment:
Q  100 aatagattaaactagttgctctaaattatttaa 132  Q
    |||||||||||||||||||||||| ||||||||    
T  3193523 aatagattaaactagttgctctaatttatttaa 3193555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 42036796 - 42036841
Alignment:
Q  1 attggctttgaacgtgcattagcggtcactcaccgcacaaacaaac 46  Q
    |||| ||||||| |||||||||||||||||||||||||||| ||||    
T  42036796 attgactttgaatgtgcattagcggtcactcaccgcacaaataaac 42036841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 100 - 134
Target Start/End: Original strand, 17854474 - 17854508
Alignment:
Q  100 aatagattaaactagttgctctaaattatttaatt 134  Q
    |||||||||||||||||||||||| ||||||||||    
T  17854474 aatagattaaactagttgctctaatttatttaatt 17854508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1318 times since January 2019
Visitors: 3844