View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0587_low_40 (Length: 210)
Name: NF0587_low_40
Description: NF0587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0587_low_40 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 37182229 - 37182274
Alignment:
Q |
1 |
attggctttgaacgtgcattagcggtcactcaccgcacaaacaaac |
46 |
Q |
|
|
|||||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
T |
37182229 |
attggctttgaacgtgcagtagcgatcactcaccgcacaaacaaac |
37182274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 37193361 - 37193406
Alignment:
Q |
1 |
attggctttgaacgtgcattagcggtcactcaccgcacaaacaaac |
46 |
Q |
|
|
|||||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
T |
37193361 |
attggctttgaacgtgcagtagcgatcactcaccgcacaaacaaac |
37193406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 100 - 132
Target Start/End: Original strand, 3193523 - 3193555
Alignment:
Q |
100 |
aatagattaaactagttgctctaaattatttaa |
132 |
Q |
|
|
|||||||||||||||||||||||| |||||||| |
|
|
T |
3193523 |
aatagattaaactagttgctctaatttatttaa |
3193555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 42036796 - 42036841
Alignment:
Q |
1 |
attggctttgaacgtgcattagcggtcactcaccgcacaaacaaac |
46 |
Q |
|
|
|||| ||||||| |||||||||||||||||||||||||||| |||| |
|
|
T |
42036796 |
attgactttgaatgtgcattagcggtcactcaccgcacaaataaac |
42036841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 100 - 134
Target Start/End: Original strand, 17854474 - 17854508
Alignment:
Q |
100 |
aatagattaaactagttgctctaaattatttaatt |
134 |
Q |
|
|
|||||||||||||||||||||||| |||||||||| |
|
|
T |
17854474 |
aatagattaaactagttgctctaatttatttaatt |
17854508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University