View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0589-Insertion-5 (Length: 342)
Name: NF0589-Insertion-5
Description: NF0589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0589-Insertion-5 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 8 - 342
Target Start/End: Complemental strand, 5829147 - 5828813
Alignment:
Q |
8 |
catgaatggtatgtttttgcggggatggattttgcaactttgttggatcttgttggtggcgtttgtgtaagaatcatatgaagggttttgcttcagggtg |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5829147 |
catgaatggtatgtttttgcggggatggattttgcaactttgttggatcttgttggtggcgtttgtgtaagaatcatatgaagggttttgcttcagggtg |
5829048 |
T |
 |
Q |
108 |
tttttccacgaatttcatgagtttgcttatgggttgtaaatttagaagatttgtgaagaactctattaaggtgtattttttggataatttggtgagtcaa |
207 |
Q |
|
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5829047 |
ttcttccacgaatttcatgagtttgcttatgggttgtaaatttagaagatttgtgaagaactctattaaggtgtattttttggataatttggtgagtcaa |
5828948 |
T |
 |
Q |
208 |
gttattgttgataatgtgtttgtgaaaagtctttattgacgatgtatttgaattttttggttgctcctctttattagttcctctctctattagacggttg |
307 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
5828947 |
gttattgttgataatgtgtttgtgaaaagtctttattgatgatgtatttgaatttttttgttgctcctctttattagttcctctctctattagacagttg |
5828848 |
T |
 |
Q |
308 |
gttcttctctttggttattgtgtcttcttttattg |
342 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |
|
|
T |
5828847 |
gttcttctctttggttattgtgtcttcttttattg |
5828813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University