View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0589-Insertion-9 (Length: 99)
Name: NF0589-Insertion-9
Description: NF0589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0589-Insertion-9 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 92; Significance: 3e-45; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 92; E-Value: 3e-45
Query Start/End: Original strand, 8 - 99
Target Start/End: Complemental strand, 8642121 - 8642030
Alignment:
| Q |
8 |
cctttatctgtcttctccaagctagctaccaccactcttgccctccgagaccatccagcctttccataagcatggtatccgaaccctccagc |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8642121 |
cctttatctgtcttctccaagctagctaccaccactcttgccctccgagaccatccagcctttccataagcatggtatccgaaccctccagc |
8642030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 92; E-Value: 3e-45
Query Start/End: Original strand, 8 - 99
Target Start/End: Complemental strand, 8648701 - 8648610
Alignment:
| Q |
8 |
cctttatctgtcttctccaagctagctaccaccactcttgccctccgagaccatccagcctttccataagcatggtatccgaaccctccagc |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8648701 |
cctttatctgtcttctccaagctagctaccaccactcttgccctccgagaccatccagcctttccataagcatggtatccgaaccctccagc |
8648610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2331 times since January 2019
Visitors: 3818