View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0589_high_17 (Length: 382)
Name: NF0589_high_17
Description: NF0589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0589_high_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 253; Significance: 1e-140; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 1 - 257
Target Start/End: Original strand, 34239952 - 34240208
Alignment:
Q |
1 |
tccatcacagtcaaaaagaagagctgagggaagcgtggaagatgctgaagccgaggctgagcaactcaacctacgtcttctggttgttgaagttgatatc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34239952 |
tccatcacagtcaaaaagaagagctgagggaagcgtggaagatgctgaagccgaggctgagcaactcaacctacgtcttctggttgttgaagttgatatc |
34240051 |
T |
 |
Q |
101 |
ttaagagctttgacagtgaaagaggatggtgaagtactgtgttgttcatgctccttcttgttgtgtttaaggaggctaataagtgttgttgtttttggtt |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34240052 |
ttaagagctttgacagtgaaagaggatggtgaagtactgtgttgttcatgctccttcttgttgtgtttaaggaggctaataagtgttgttgtttttggtt |
34240151 |
T |
 |
Q |
201 |
gatgagttcgattcaacaatgaagcagatgaaatggagatgatgctatttactgatg |
257 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
34240152 |
gatgagttcgattcaacaatgaagcagatgaaatggagatgatgctatttgctgatg |
34240208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University