View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0589_high_22 (Length: 345)
Name: NF0589_high_22
Description: NF0589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0589_high_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 106; Significance: 5e-53; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 127 - 244
Target Start/End: Original strand, 45659244 - 45659361
Alignment:
| Q |
127 |
tagcttagttctatatttttatggagtgatgcactttgatataccaagttctgccaatactctcacaaacttcatgggttcaactttcttgctctctctt |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45659244 |
tagcttagttctatatttttatggagtgatgcactttgatataccaagttctgcaaatactctcacaaacttcatgggttcaactttcttgctttctcta |
45659343 |
T |
 |
| Q |
227 |
gttggtggcttcatctca |
244 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
45659344 |
gttggtggcttcatctca |
45659361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 57; Significance: 9e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 128 - 244
Target Start/End: Complemental strand, 37984296 - 37984180
Alignment:
| Q |
128 |
agcttagttctatatttttatggagtgatgcactttgatataccaagttctgccaatactctcacaaacttcatgggttcaactttcttgctctctcttg |
227 |
Q |
| |
|
|||||||| ||||| ||| ||||||||||||||||||| | |||| |||||||| ||| | ||||| || ||||| |||||||||||||||||||||| |
|
|
| T |
37984296 |
agcttagtactatactttattggagtgatgcactttgatctttcaagctctgccaacactttgacaaattttatgggctcaactttcttgctctctcttg |
37984197 |
T |
 |
| Q |
228 |
ttggtggcttcatctca |
244 |
Q |
| |
|
|||||| |||||||||| |
|
|
| T |
37984196 |
ttggtgccttcatctca |
37984180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University