View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0589_high_30 (Length: 310)
Name: NF0589_high_30
Description: NF0589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0589_high_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 52512460 - 52512657
Alignment:
| Q |
1 |
aattgaaattgaattgaagctcgtatataaacatacatgcataccttggaggaagaatgatacccttgattttgaggaagagtggatttaacaataaaac |
100 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52512460 |
aattgaaattgaattgaaactcatatataaacatacatacataccttggaggaagaatgatatccttgattttgaggaagagtggatttaacaataaaac |
52512559 |
T |
|
| Q |
101 |
aacgcgtccttcctgtttgtttgatggaagttggaggaaggcatcgaggaataacagacgcctgcaaattgcaatccattgagatatgaagaatagag |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52512560 |
aacgcgtccttcctgtttgtttgatggaagttggaggaaggcatcgaggaataacagacgcctgcaaattgcaatccattgagatatgaagaatagag |
52512657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1311 times since January 2019
Visitors: 3844