View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0589_high_34 (Length: 275)
Name: NF0589_high_34
Description: NF0589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0589_high_34 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 3e-57; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 6 - 138
Target Start/End: Complemental strand, 43569412 - 43569282
Alignment:
| Q |
6 |
aattactcttttaggagattgttaagattaattaaggagagaaaatgacgattataagggatttagtgagaatgatagtaatcagttttctaatgataga |
105 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43569412 |
aattactcttttaagagattgttaagattaattaaggagagaaaatgacgattataagggatttagtgagaatgatagtaatcagttttctaatgataga |
43569313 |
T |
|
| Q |
106 |
tagatagtattagtagtagacagaagaagaaac |
138 |
Q |
| |
|
||| || |||||||||||||||||||||||||| |
|
|
| T |
43569312 |
tag-ta-tattagtagtagacagaagaagaaac |
43569282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 703 times since January 2019
Visitors: 3837