View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0589_high_38 (Length: 251)

Name: NF0589_high_38
Description: NF0589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0589_high_38
NF0589_high_38
[»] chr6 (3 HSPs)
chr6 (3-239)||(2140045-2140282)
chr6 (118-185)||(2146046-2146113)
chr6 (77-115)||(2124784-2124822)


Alignment Details
Target: chr6 (Bit Score: 226; Significance: 1e-125; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 3 - 239
Target Start/End: Complemental strand, 2140282 - 2140045
Alignment:
3 gtggagctggtgaagaagctggtgttttggctggttgagaaggtggaacggttattattggaattgcaacagtaggagctgaaggttttacatagttcac 102  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
2140282 gtggagctggtgaagaagctggtgttttggctggttgagaaggtggaacggttattattggaattacaacagtaggagctgaaggttttacatagttcac 2140183  T
103 ctgcaccaaatattttaatttttcaaacttctttttaacaaaa-aatatgctaccatctaacattatgttaatgcttaaattgataatgactttagcaaa 201  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2140182 ctgcaccaaatattttaatttttcaaacttctttttaacaaaataatatgctaccatctaacattatgttaatgcttaaattgataatgactttagcaaa 2140083  T
202 atcattgtcatttagtaattttgttaaaatttaagtat 239  Q
    ||||||||||||||||||||||||||||||||||||||    
2140082 atcattgtcatttagtaattttgttaaaatttaagtat 2140045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 118 - 185
Target Start/End: Complemental strand, 2146113 - 2146046
Alignment:
118 taatttttcaaacttctttttaacaaaaaatatgctaccatctaacattatgttaatgcttaaattga 185  Q
    |||||| | ||| ||||||||||||| ||| |||||||||||||||||| | | ||||||| ||||||    
2146113 taatttatgaaatttctttttaacaagaaaaatgctaccatctaacattctttgaatgcttgaattga 2146046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 77 - 115
Target Start/End: Complemental strand, 2124822 - 2124784
Alignment:
77 ggagctgaaggttttacatagttcacctgcaccaaatat 115  Q
    ||||||| ||| |||||||||||||||||||||||||||    
2124822 ggagctgtaggatttacatagttcacctgcaccaaatat 2124784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1304 times since January 2019
Visitors: 3844