View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0589_high_41 (Length: 234)

Name: NF0589_high_41
Description: NF0589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0589_high_41
NF0589_high_41
[»] chr3 (2 HSPs)
chr3 (30-212)||(10283503-10283685)
chr3 (128-193)||(10278879-10278947)


Alignment Details
Target: chr3 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 30 - 212
Target Start/End: Original strand, 10283503 - 10283685
Alignment:
30 cagagagtatgaaatgaaatgtgatgaagaaaaaatcacgtagatnnnnnnnnnnnnnnnggagaaggttttgaagtattttaaaatagaaaagagggag 129  Q
    ||||||||||| ||||||||||||||||||| |||||||||||||               |||||||||||||| |||||||||||||||||||||||||    
10283503 cagagagtatggaatgaaatgtgatgaagaagaaatcacgtagatgagagagagagaaagggagaaggttttgatgtattttaaaatagaaaagagggag 10283602  T
130 aggacaaagatatggagtgtcatgtgacgaagtattttatgccatgcgattgggaaagtacgccgtaggcttacggcaagacc 212  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10283603 aggacaaagatatggagtgtcatgtgacgaagtattttatgccatgcgattgggaaagtacgccgtaggcttacggcaagacc 10283685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 128 - 193
Target Start/End: Original strand, 10278879 - 10278947
Alignment:
128 agaggacaaagatatggagt----gtcatgtgacgaagtattttatgccatgcgattgggaaagtacgcc 193  Q
    ||||||||||||||||||||    |||||||||||| |||||||||| | |||||| |||||||||||||    
10278879 agaggacaaagatatggagtgagtgtcatgtgacgatgtattttatgtc-tgcgatcgggaaagtacgcc 10278947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 50 times since January 2019
Visitors: 3831