View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0589_high_43 (Length: 232)

Name: NF0589_high_43
Description: NF0589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0589_high_43
NF0589_high_43
[»] chr3 (1 HSPs)
chr3 (1-123)||(37108341-37108463)


Alignment Details
Target: chr3 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 37108463 - 37108341
Alignment:
1 attaatggcgacgagtgctttgatgcagacatacttgcagcatttgatgcagctatccatgatggtgttgatgtcttgtctgtgtcacttggtggctctg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37108463 attaatggcgacgagtgctttgatgcagacatacttgcagcatttgatgcagctatccatgatggtgttgatgtcttgtctgtgtcacttggtggctctg 37108364  T
101 cttctaaccttttcaatgatagt 123  Q
    |||||||||||||||||||||||    
37108363 cttctaaccttttcaatgatagt 37108341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University