View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0589_low_28 (Length: 345)

Name: NF0589_low_28
Description: NF0589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0589_low_28
NF0589_low_28
[»] chr7 (1 HSPs)
chr7 (127-244)||(45659244-45659361)
[»] chr1 (1 HSPs)
chr1 (128-244)||(37984180-37984296)


Alignment Details
Target: chr7 (Bit Score: 106; Significance: 5e-53; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 127 - 244
Target Start/End: Original strand, 45659244 - 45659361
Alignment:
127 tagcttagttctatatttttatggagtgatgcactttgatataccaagttctgccaatactctcacaaacttcatgggttcaactttcttgctctctctt 226  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||     
45659244 tagcttagttctatatttttatggagtgatgcactttgatataccaagttctgcaaatactctcacaaacttcatgggttcaactttcttgctttctcta 45659343  T
227 gttggtggcttcatctca 244  Q
    ||||||||||||||||||    
45659344 gttggtggcttcatctca 45659361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 57; Significance: 9e-24; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 128 - 244
Target Start/End: Complemental strand, 37984296 - 37984180
Alignment:
128 agcttagttctatatttttatggagtgatgcactttgatataccaagttctgccaatactctcacaaacttcatgggttcaactttcttgctctctcttg 227  Q
    |||||||| ||||| |||  ||||||||||||||||||| |  |||| |||||||| ||| | ||||| || ||||| ||||||||||||||||||||||    
37984296 agcttagtactatactttattggagtgatgcactttgatctttcaagctctgccaacactttgacaaattttatgggctcaactttcttgctctctcttg 37984197  T
228 ttggtggcttcatctca 244  Q
    |||||| ||||||||||    
37984196 ttggtgccttcatctca 37984180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 42 times since January 2019
Visitors: 3832