View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0589_low_30 (Length: 334)
Name: NF0589_low_30
Description: NF0589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0589_low_30 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 114; Significance: 9e-58; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 114; E-Value: 9e-58
Query Start/End: Original strand, 115 - 236
Target Start/End: Complemental strand, 2140332 - 2140211
Alignment:
| Q |
115 |
acccttccatgatttgactattggagttggcttggtctttgaagatggtggtggagctggtgaagaagctggtgttttggctggttgagaaggtggaacg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2140332 |
acccttccatgatttgactattggagttggcttggtctttgaagttggtggtggagctggtgaagaagctggtgttttggctggttgagaaggtggaacg |
2140233 |
T |
|
| Q |
215 |
gttattattggaattgcaacag |
236 |
Q |
| |
|
||||||||||||||| |||||| |
|
|
| T |
2140232 |
gttattattggaattacaacag |
2140211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 763 times since January 2019
Visitors: 3837