View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0589_low_31 (Length: 334)
Name: NF0589_low_31
Description: NF0589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0589_low_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 34239976 - 34239773
Alignment:
| Q |
1 |
agctcttctttttgactgtgatggagtccttgtagatactgaaaaagatggtcaccgcatttctttcaatgatactttccaagaggtgcctcctgctttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34239976 |
agctcttctttttgactgtgatggagtccttgtagatactgaaaaagatggtcaccgcatttctttcaatgatactttccaagaggtgcctcctgctttt |
34239877 |
T |
 |
| Q |
101 |
taatctttcttttttcacaagtaaatattacttcttattatggttataactattcttaatagaagtcattgataagataaaagtatagaacaactagcgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34239876 |
taatctttcttttttcacaagtaaatattacttcttattatggttataactattcttaatagaagtcattgataagataaaagtatagaacaactagcgt |
34239777 |
T |
 |
| Q |
201 |
gtac |
204 |
Q |
| |
|
|||| |
|
|
| T |
34239776 |
gtac |
34239773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 149 - 185
Target Start/End: Complemental strand, 484020 - 483984
Alignment:
| Q |
149 |
actattcttaatagaagtcattgataagataaaagta |
185 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
484020 |
actattcttaatagaagtcattgataagagaaaagta |
483984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University