View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0589_low_34 (Length: 327)
Name: NF0589_low_34
Description: NF0589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0589_low_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 64 - 298
Target Start/End: Complemental strand, 32620440 - 32620205
Alignment:
Q |
64 |
gatgaaccatgtaaacacaaaaatgtaaaaaatacgggcttcaaaaatctcatctcataggttataatcttgctatacttggcaagtaaggttggaaatt |
163 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
32620440 |
gatgaaccatgtaaacacaaaaatgtaaaaaatatgggcttcaaaaatctcatctcataggttataatcttgctatgcttggcaagtaaggttggaaatt |
32620341 |
T |
 |
Q |
164 |
tatgtcaaagccaaattgtggagtatcccg-cttttttgggtagatatttccctccagtgattatcttgatttatgtataggatatgatgcaagttatgt |
262 |
Q |
|
|
|||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32620340 |
tatgtcaaagccaaattgtggagtatcccgcctttttggggtagatatttccctccagtgattatcttgatttatgtataggatatgatgcaagttatgt |
32620241 |
T |
 |
Q |
263 |
gtggcggagtatttgaaatgtaaaatgtgttgtttg |
298 |
Q |
|
|
|||||||| |||||| |||||||||||||||||||| |
|
|
T |
32620240 |
gtggcggaatatttggaatgtaaaatgtgttgtttg |
32620205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 112 times since January 2019
Visitors: 3832