View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0589_low_41 (Length: 311)
Name: NF0589_low_41
Description: NF0589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0589_low_41 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 90 - 241
Target Start/End: Complemental strand, 5270267 - 5270116
Alignment:
| Q |
90 |
ctttgtagtctcttcatcacaatttttcattatttatcctttcctatcatattttcccattaacaacgacgttaccctctttaattgctcttcaattgga |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
5270267 |
ctttgtagtctcttcatcacaatttttcattatttatcctttcctatcatattttccctttaacaacgacgttaccctctttaattgctcttcaattgaa |
5270168 |
T |
|
| Q |
190 |
caacaccatctcaaaagctagaaacaaacaaacattggtagctacgacctat |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5270167 |
caacaccatctcaaaagctagaaacaaacaaacattggtagcaacgacctat |
5270116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2530 times since January 2019
Visitors: 3822