View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0589_low_44 (Length: 298)
Name: NF0589_low_44
Description: NF0589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0589_low_44 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 29 - 203
Target Start/End: Original strand, 43616913 - 43617087
Alignment:
Q |
29 |
aacaaaatttagtgaacagaaaaataattattaattgaagtgagagtaatgacaattttacaacatgaaatttgaatttcttttcctaaaggttacaatg |
128 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43616913 |
aacaaaatttagtgaacagaaaaataattattaattgaagtgagagtaatgacaattttacaacatgaaatttgaatttcttttcctaaaggttacaatg |
43617012 |
T |
 |
Q |
129 |
tcaaattctcacaactaagctaacaccaaaccttttgaataaaaataggctcagttacttaagagctacccttca |
203 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43617013 |
tcaaattctcacaactaagctaacaccaaaccttttgaataaaaataggctcagttacttaagagctacccttca |
43617087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 288 times since January 2019
Visitors: 3833