View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0589_low_49 (Length: 275)

Name: NF0589_low_49
Description: NF0589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0589_low_49
NF0589_low_49
[»] chr7 (1 HSPs)
chr7 (6-138)||(43569282-43569412)


Alignment Details
Target: chr7 (Bit Score: 113; Significance: 3e-57; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 6 - 138
Target Start/End: Complemental strand, 43569412 - 43569282
Alignment:
6 aattactcttttaggagattgttaagattaattaaggagagaaaatgacgattataagggatttagtgagaatgatagtaatcagttttctaatgataga 105  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43569412 aattactcttttaagagattgttaagattaattaaggagagaaaatgacgattataagggatttagtgagaatgatagtaatcagttttctaatgataga 43569313  T
106 tagatagtattagtagtagacagaagaagaaac 138  Q
    ||| || ||||||||||||||||||||||||||    
43569312 tag-ta-tattagtagtagacagaagaagaaac 43569282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University