View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0589_low_51 (Length: 272)
Name: NF0589_low_51
Description: NF0589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0589_low_51 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 32 - 229
Target Start/End: Complemental strand, 13976490 - 13976295
Alignment:
Q |
32 |
taggcaaatgcatctgagatatatatttgttatgatagcacaaaacgatataagtaannnnnnnnn-atctgatagaaattcatttatgaaaaataaatt |
130 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
13976490 |
taggcaaatgcatctgagatatatatttgttatgatagcacaaaacgatataagtaatattttttttatctgatagaaattcatttatgaaaaataaatt |
13976391 |
T |
 |
Q |
131 |
gaggagacataaacctaatccaattgaagagaaaaagacaaacnnnnnnnnnnnncttttcatattatgtaagaatttcattcctatatcctcgaatat |
229 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13976390 |
gaggagacataaacctaatccaattgaag-gaaaaagacaaac--aaaaaaaaagcttttcatattatgtaagaatttcattcctatatcctcgaatat |
13976295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 110 times since January 2019
Visitors: 3832