View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0589_low_58 (Length: 251)
Name: NF0589_low_58
Description: NF0589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0589_low_58 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 226; Significance: 1e-125; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 3 - 239
Target Start/End: Complemental strand, 2140282 - 2140045
Alignment:
Q |
3 |
gtggagctggtgaagaagctggtgttttggctggttgagaaggtggaacggttattattggaattgcaacagtaggagctgaaggttttacatagttcac |
102 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
2140282 |
gtggagctggtgaagaagctggtgttttggctggttgagaaggtggaacggttattattggaattacaacagtaggagctgaaggttttacatagttcac |
2140183 |
T |
 |
Q |
103 |
ctgcaccaaatattttaatttttcaaacttctttttaacaaaa-aatatgctaccatctaacattatgttaatgcttaaattgataatgactttagcaaa |
201 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2140182 |
ctgcaccaaatattttaatttttcaaacttctttttaacaaaataatatgctaccatctaacattatgttaatgcttaaattgataatgactttagcaaa |
2140083 |
T |
 |
Q |
202 |
atcattgtcatttagtaattttgttaaaatttaagtat |
239 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |
|
|
T |
2140082 |
atcattgtcatttagtaattttgttaaaatttaagtat |
2140045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 118 - 185
Target Start/End: Complemental strand, 2146113 - 2146046
Alignment:
Q |
118 |
taatttttcaaacttctttttaacaaaaaatatgctaccatctaacattatgttaatgcttaaattga |
185 |
Q |
|
|
|||||| | ||| ||||||||||||| ||| |||||||||||||||||| | | ||||||| |||||| |
|
|
T |
2146113 |
taatttatgaaatttctttttaacaagaaaaatgctaccatctaacattctttgaatgcttgaattga |
2146046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 77 - 115
Target Start/End: Complemental strand, 2124822 - 2124784
Alignment:
Q |
77 |
ggagctgaaggttttacatagttcacctgcaccaaatat |
115 |
Q |
|
|
||||||| ||| ||||||||||||||||||||||||||| |
|
|
T |
2124822 |
ggagctgtaggatttacatagttcacctgcaccaaatat |
2124784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 80 times since January 2019
Visitors: 3831