View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0589_low_61 (Length: 245)
Name: NF0589_low_61
Description: NF0589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0589_low_61 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 49 - 237
Target Start/End: Complemental strand, 3442722 - 3442534
Alignment:
| Q |
49 |
agcataggttaactctagaaaaattgtcgttattgtggagccagaaacctgcaaaattagcggggttagaatcaaaggtgacataattataatttccttc |
148 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3442722 |
agcatgggttaactctagaaaaattatcgttattgtggagccagaaacctgcaaaattagcggggttagaatcaaaggtgacataattataatttccttc |
3442623 |
T |
|
| Q |
149 |
atgattatgcattattgtttttgtagttttctttattgtggagccagacttggaataatattaacaatagtagtctttgttcctatgat |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3442622 |
atgattatgcattattgtttttgtagttttctttattgtggagccagacttggaataatattaataatagtagtctttgttcctatgat |
3442534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2590 times since January 2019
Visitors: 3822