View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0589_low_62 (Length: 241)
Name: NF0589_low_62
Description: NF0589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0589_low_62 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 37108463 - 37108341
Alignment:
Q |
1 |
attaatggcgacgagtgctttgatgcagacatacttgcagcatttgatgcagctatccatgatggtgttgatgtcttgtctgtgtcacttggtggctctg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37108463 |
attaatggcgacgagtgctttgatgcagacatacttgcagcatttgatgcagctatccatgatggtgttgatgtcttgtctgtgtcacttggtggctctg |
37108364 |
T |
 |
Q |
101 |
cttctaaccttttcaatgatagt |
123 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
37108363 |
cttctaaccttttcaatgatagt |
37108341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 297 times since January 2019
Visitors: 3833