View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0589_low_63 (Length: 234)
Name: NF0589_low_63
Description: NF0589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0589_low_63 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 30 - 212
Target Start/End: Original strand, 10283503 - 10283685
Alignment:
| Q |
30 |
cagagagtatgaaatgaaatgtgatgaagaaaaaatcacgtagatnnnnnnnnnnnnnnnggagaaggttttgaagtattttaaaatagaaaagagggag |
129 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||||||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10283503 |
cagagagtatggaatgaaatgtgatgaagaagaaatcacgtagatgagagagagagaaagggagaaggttttgatgtattttaaaatagaaaagagggag |
10283602 |
T |
 |
| Q |
130 |
aggacaaagatatggagtgtcatgtgacgaagtattttatgccatgcgattgggaaagtacgccgtaggcttacggcaagacc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10283603 |
aggacaaagatatggagtgtcatgtgacgaagtattttatgccatgcgattgggaaagtacgccgtaggcttacggcaagacc |
10283685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 128 - 193
Target Start/End: Original strand, 10278879 - 10278947
Alignment:
| Q |
128 |
agaggacaaagatatggagt----gtcatgtgacgaagtattttatgccatgcgattgggaaagtacgcc |
193 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||| | |||||| ||||||||||||| |
|
|
| T |
10278879 |
agaggacaaagatatggagtgagtgtcatgtgacgatgtattttatgtc-tgcgatcgggaaagtacgcc |
10278947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University