View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0589_low_66 (Length: 231)
Name: NF0589_low_66
Description: NF0589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0589_low_66 |
 |  |
|
| [»] scaffold0891 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 1 - 144
Target Start/End: Complemental strand, 35775386 - 35775243
Alignment:
| Q |
1 |
ggttctaggcttgttggatgtagaaaatgttttaaagattgactaattcaaacaagatgacatccgttcaagtttatattgtgaaactttattcccttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35775386 |
ggttctaggcttgttggatgtagaaaatgttttaaagattgactaattcaaacaagatgacatccgttcaagtttatattgtgaaactttattcccttta |
35775287 |
T |
 |
| Q |
101 |
acttactttaatcaaatttttaggtgaaacttttattgatgatg |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35775286 |
acttactttaatcaaatttttaggtgaaacttttattgatgatg |
35775243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0891 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: scaffold0891
Description:
Target: scaffold0891; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 82 - 144
Target Start/End: Original strand, 2786 - 2848
Alignment:
| Q |
82 |
tgaaactttattccctttaacttactttaatcaaatttttaggtgaaacttttattgatgatg |
144 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
2786 |
tgaaactttattcccttgaacttactttaatcaaatttttagatgaaacttttatcgatgatg |
2848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University