View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| ||||||||||||||||
Alignment Overview
Query: NF0589_low_66 (Length: 231)
Name: NF0589_low_66
Description: NF0589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| |||||
| ||||||
| ||||||
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 1 - 144
Target Start/End: Complemental strand, 35775386 - 35775243
Alignment:
| Q | 1 | ggttctaggcttgttggatgtagaaaatgttttaaagattgactaattcaaacaagatgacatccgttcaagtttatattgtgaaactttattcccttta | 100 | Q |
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||
| T | 35775386 | ggttctaggcttgttggatgtagaaaatgttttaaagattgactaattcaaacaagatgacatccgttcaagtttatattgtgaaactttattcccttta | 35775287 | T |
 | ||||
| Q | 101 | acttactttaatcaaatttttaggtgaaacttttattgatgatg | 144 | Q |
| |||||||||||||||||||||||||||||||||||||||||||| | ||||
| T | 35775286 | acttactttaatcaaatttttaggtgaaacttttattgatgatg | 35775243 | T |
| ||||
Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0891 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: scaffold0891
Description:
Target: scaffold0891; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 82 - 144
Target Start/End: Original strand, 2786 - 2848
Alignment:
| Q | 82 | tgaaactttattccctttaacttactttaatcaaatttttaggtgaaacttttattgatgatg | 144 | Q |
| ||||||||||||||||| |||||||||||||||||||||||| |||||||||||| ||||||| | ||||
| T | 2786 | tgaaactttattcccttgaacttactttaatcaaatttttagatgaaacttttatcgatgatg | 2848 | T |
| ||||
Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University