View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0590_high_7 (Length: 309)
Name: NF0590_high_7
Description: NF0590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0590_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 106 - 280
Target Start/End: Complemental strand, 53588477 - 53588302
Alignment:
Q |
106 |
aattacattacaatcttgatggaagcaggtcatcgtaacgaaaatggtaaaagcgggccaccttaacgaattgccttaaaaaa-tttggaccacctcaat |
204 |
Q |
|
|
|||| |||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
T |
53588477 |
aattgcattacaatcttaatggaagcaggtcatcgtaatgaaaatggtaaaagcgggccaccttaacgaactgccttaaaaaaatttggaccacctcaat |
53588378 |
T |
 |
Q |
205 |
taggacgaactgtcttacagttatcaataaaagatataattacaaaagactcttacaatacaaatgacagagaaat |
280 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53588377 |
taggacgaactgtcttacagttatcaataaaagatataattacaaaagactcttacaatacaaatgacagagaaat |
53588302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University