View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0590_low_10 (Length: 309)
Name: NF0590_low_10
Description: NF0590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0590_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 94 - 296
Target Start/End: Complemental strand, 34164501 - 34164300
Alignment:
Q |
94 |
tacacacactatggtcttatgctagaacctatcatcaagcaaaatatatgaaacttaagctaataattcaaatttccaacaacaacaaaaagtgaaactt |
193 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
T |
34164501 |
tacacacactatggtcttatgctagaacctatcatcaagcaaaatatatgaaacttaagctaataattcaaatttcaaacaacaa-aaaaagtgaaactt |
34164403 |
T |
 |
Q |
194 |
acgagtgaggaaataagaaacggcgaaaatagagagagcccaccaaagagtgcggagcttaaactcttggatcagatcattcacactctccatgggtttc |
293 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34164402 |
acgagtgaggaaataagaaacggcgaaaatagagagagcccaccaaagagtgcggagcttaaactcttggatcagatcattcacactctccatgggtttc |
34164303 |
T |
 |
Q |
294 |
ttc |
296 |
Q |
|
|
||| |
|
|
T |
34164302 |
ttc |
34164300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 218 times since January 2019
Visitors: 3831