View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0590_low_14 (Length: 264)
Name: NF0590_low_14
Description: NF0590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0590_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 42 - 243
Target Start/End: Original strand, 56475252 - 56475453
Alignment:
| Q |
42 |
caacattgtcttcaatctttcccgatctaacctccaccacacaaccttacgccgcccgcgacctccacctcctcnnnnnnnncctcatgcccccaccaca |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| ||||||||||| |
|
|
| T |
56475252 |
caacattgtcttcaatctttcccgatctaacctccaccacacaaccttacgccgcccgcgacctccacctcatcttttttttcctcatacccccaccaca |
56475351 |
T |
|
| Q |
142 |
caaccttcaagatctgcatttttgaaagatggagagagacgacacaatgttgcagggagtgaactttgtgattgagtccgtgacaattcagtggcctatg |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| ||| |
|
|
| T |
56475352 |
caaccttcaagatctgcatttttgaaagatggagagagacgaaacaatgttgcagggagtgaactttgtgattgagtccgtgacaatgcagtggccaatg |
56475451 |
T |
|
| Q |
242 |
at |
243 |
Q |
| |
|
|| |
|
|
| T |
56475452 |
at |
56475453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 300 times since January 2019
Visitors: 3833