View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0590_low_17 (Length: 250)
Name: NF0590_low_17
Description: NF0590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0590_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 23 - 243
Target Start/End: Complemental strand, 41481777 - 41481557
Alignment:
| Q |
23 |
atattattagaatcacagagtggaatagtatatccattttggataaatttgcgctacagcttaaatttaataaatcctgttggcnnnnnnncgaaatacc |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
41481777 |
atattattagaatcacagagtggaatagtatatccattttggataaatttgcgctacagcttaaatttaataaatcctgttggctttttttcgatatacc |
41481678 |
T |
|
| Q |
123 |
ttttaattgttgcccaaattaaatttagtgactaacaacaatcacataagccaacaaaatgtagaatacattgaaaaaattctaacaagtggagtaaaat |
222 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41481677 |
ttttaattgttgcccaaattgaatttattgactaacaacaatcacataagccaacaaaatgtagaatacattgaaaaaattctaacaagtggagtaaaat |
41481578 |
T |
|
| Q |
223 |
atagagggacgcatattcttc |
243 |
Q |
| |
|
|||||||||| |||||||||| |
|
|
| T |
41481577 |
atagagggacacatattcttc |
41481557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 47 times since January 2019
Visitors: 3831