View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0590_low_2 (Length: 520)

Name: NF0590_low_2
Description: NF0590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0590_low_2
NF0590_low_2
[»] scaffold0568 (6 HSPs)
scaffold0568 (264-390)||(2505-2631)
scaffold0568 (264-390)||(9107-9233)
scaffold0568 (63-201)||(2304-2442)
scaffold0568 (63-201)||(8906-9044)
scaffold0568 (460-507)||(2701-2748)
scaffold0568 (460-507)||(9303-9350)
[»] chr4 (3 HSPs)
chr4 (264-390)||(17060530-17060655)
chr4 (63-199)||(17060328-17060464)
chr4 (460-507)||(17060725-17060772)
[»] chr1 (3 HSPs)
chr1 (264-390)||(48223997-48224123)
chr1 (149-201)||(48223874-48223926)
chr1 (460-507)||(48224181-48224228)
[»] chr2 (1 HSPs)
chr2 (63-119)||(29158133-29158189)
[»] chr5 (1 HSPs)
chr5 (462-507)||(5357353-5357398)


Alignment Details
Target: scaffold0568 (Bit Score: 115; Significance: 3e-58; HSPs: 6)
Name: scaffold0568
Description:

Target: scaffold0568; HSP #1
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 264 - 390
Target Start/End: Original strand, 2505 - 2631
Alignment:
264 ggttcagcacgtgttggtgtggttgggggcttggtttggtgtggtgttatgcatagggggtcattgttcttgtccggctgcctttccggatagtttttgg 363  Q
    ||||||||||||||||||||| ||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2505 ggttcagcacgtgttggtgtgcttgggggctgggtttggtgcggtgttatgcatagggggtcattgttcttgtccggctgcctttccggatagtttttgg 2604  T
364 gtctttgtatacctttgcatcagtcac 390  Q
    |||||||||||||||||||||||||||    
2605 gtctttgtatacctttgcatcagtcac 2631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0568; HSP #2
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 264 - 390
Target Start/End: Original strand, 9107 - 9233
Alignment:
264 ggttcagcacgtgttggtgtggttgggggcttggtttggtgtggtgttatgcatagggggtcattgttcttgtccggctgcctttccggatagtttttgg 363  Q
    ||||||||||||||||||||| ||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9107 ggttcagcacgtgttggtgtgcttgggggctgggtttggtgcggtgttatgcatagggggtcattgttcttgtccggctgcctttccggatagtttttgg 9206  T
364 gtctttgtatacctttgcatcagtcac 390  Q
    |||||||||||||||||||||||||||    
9207 gtctttgtatacctttgcatcagtcac 9233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0568; HSP #3
Raw Score: 98; E-Value: 5e-48
Query Start/End: Original strand, 63 - 201
Target Start/End: Original strand, 2304 - 2442
Alignment:
63 cctagctgttgccattatttgacccaaatatatctcccaaaaatgtggttataattgtaaaattttgacaggttctgannnnnnngtgttcacaggttct 162  Q
    |||| ||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||        |||||| ||||||||    
2304 cctacctgttgccattatttgacccaaatataactcccaaaaatgtggttataattgcaaaattttgacaggttctggtttttttgtgttcgcaggttct 2403  T
163 gtttgctgttttggtgggtgctgccttctgttaggggcg 201  Q
    |||||||||||||||||||||||||||||||||||||||    
2404 gtttgctgttttggtgggtgctgccttctgttaggggcg 2442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0568; HSP #4
Raw Score: 98; E-Value: 5e-48
Query Start/End: Original strand, 63 - 201
Target Start/End: Original strand, 8906 - 9044
Alignment:
63 cctagctgttgccattatttgacccaaatatatctcccaaaaatgtggttataattgtaaaattttgacaggttctgannnnnnngtgttcacaggttct 162  Q
    |||| ||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||        |||||| ||||||||    
8906 cctacctgttgccattatttgacccaaatataactcccaaaaatgtggttataattgcaaaattttgacaggttctggtttttttgtgttcgcaggttct 9005  T
163 gtttgctgttttggtgggtgctgccttctgttaggggcg 201  Q
    |||||||||||||||||||||||||||||||||||||||    
9006 gtttgctgttttggtgggtgctgccttctgttaggggcg 9044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0568; HSP #5
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 460 - 507
Target Start/End: Original strand, 2701 - 2748
Alignment:
460 caggtgttccgcctatatacgacacccttgtctgtgttgatttgtttc 507  Q
    |||||||||||||||||||||||| |||||| ||||||||||||||||    
2701 caggtgttccgcctatatacgacaaccttgtttgtgttgatttgtttc 2748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0568; HSP #6
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 460 - 507
Target Start/End: Original strand, 9303 - 9350
Alignment:
460 caggtgttccgcctatatacgacacccttgtctgtgttgatttgtttc 507  Q
    |||||||||||||||||||||||| |||||| ||||||||||||||||    
9303 caggtgttccgcctatatacgacaaccttgtttgtgttgatttgtttc 9350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 111; Significance: 8e-56; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 111; E-Value: 8e-56
Query Start/End: Original strand, 264 - 390
Target Start/End: Original strand, 17060530 - 17060655
Alignment:
264 ggttcagcacgtgttggtgtggttgggggcttggtttggtgtggtgttatgcatagggggtcattgttcttgtccggctgcctttccggatagtttttgg 363  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||    
17060530 ggttcagcacgtgttggtgtggttgggggcttggtttggtgcggtgttatgcatagggggtcattgttcttgtctggctgcctttccggatag-ttttgg 17060628  T
364 gtctttgtatacctttgcatcagtcac 390  Q
    |||||||||||||||||||||||||||    
17060629 gtctttgtatacctttgcatcagtcac 17060655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 63 - 199
Target Start/End: Original strand, 17060328 - 17060464
Alignment:
63 cctagctgttgccattatttgacccaaatatatctcccaaaaatgtggttataattgtaaaattttgacaggttctgannnnnnngtgttcacaggttct 162  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| ||        |||||| ||||||||    
17060328 cctacctgttgccattatttgacccaaatatatctcccaaaaatgtggttataattgcaaaattttgaccggttatggtttttttgtgttcgcaggttct 17060427  T
163 gtttgctgttttggtgggtgctgccttctgttagggg 199  Q
    |||||||||||||||||||||||||||||||||||||    
17060428 gtttgctgttttggtgggtgctgccttctgttagggg 17060464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 460 - 507
Target Start/End: Original strand, 17060725 - 17060772
Alignment:
460 caggtgttccgcctatatacgacacccttgtctgtgttgatttgtttc 507  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||    
17060725 caggtgttccgcctatatacgacacccttgtttgtgttgatttgtttc 17060772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 107; Significance: 2e-53; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 264 - 390
Target Start/End: Original strand, 48223997 - 48224123
Alignment:
264 ggttcagcacgtgttggtgtggttgggggcttggtttggtgtggtgttatgcatagggggtcattgttcttgtccggctgcctttccggatagtttttgg 363  Q
    ||||||||||||||||||||| ||||||||| ||||||||| || ||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
48223997 ggttcagcacgtgttggtgtgcttgggggctgggtttggtgcggcgttatgcgtagggggtcattgttcttgtccggctgcctttccggatagtttttgg 48224096  T
364 gtctttgtatacctttgcatcagtcac 390  Q
    |||||||||||||||||||||||||||    
48224097 gtctttgtatacctttgcatcagtcac 48224123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 149 - 201
Target Start/End: Original strand, 48223874 - 48223926
Alignment:
149 tgttcacaggttctgtttgctgttttggtgggtgctgccttctgttaggggcg 201  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||| |||||    
48223874 tgttcgcaggttctgtttgctgttttggtgggtgctgccttctgttaagggcg 48223926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 460 - 507
Target Start/End: Original strand, 48224181 - 48224228
Alignment:
460 caggtgttccgcctatatacgacacccttgtctgtgttgatttgtttc 507  Q
    |||||||||||||||||||||||| |||||| ||||||||||||||||    
48224181 caggtgttccgcctatatacgacatccttgtttgtgttgatttgtttc 48224228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 41; Significance: 0.00000000000005; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 63 - 119
Target Start/End: Original strand, 29158133 - 29158189
Alignment:
63 cctagctgttgccattatttgacccaaatatatctcccaaaaatgtggttataattg 119  Q
    |||| ||||||||| |||||||||||||||||||||||| |||||||| ||||||||    
29158133 cctacctgttgccaatatttgacccaaatatatctcccagaaatgtggctataattg 29158189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 462 - 507
Target Start/End: Original strand, 5357353 - 5357398
Alignment:
462 ggtgttccgcctatatacgacacccttgtctgtgttgatttgtttc 507  Q
    ||||||||||||||||||| ||||||||| ||| ||| ||||||||    
5357353 ggtgttccgcctatatacggcacccttgtttgtattggtttgtttc 5357398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University