View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0590_low_21 (Length: 230)

Name: NF0590_low_21
Description: NF0590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0590_low_21
NF0590_low_21
[»] chr3 (1 HSPs)
chr3 (1-64)||(3811107-3811170)


Alignment Details
Target: chr3 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 64
Target Start/End: Original strand, 3811107 - 3811170
Alignment:
1 acattaatgagctatattccattgaaacacatcttcagcacatgcataacctcacgcttcacag 64  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3811107 acattaatgagctatattccattgaaacacatcttcagcacatgcataacctcacgcttcacag 3811170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 755 times since January 2019
Visitors: 3837