View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0590_low_25 (Length: 209)
Name: NF0590_low_25
Description: NF0590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0590_low_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 33 - 179
Target Start/End: Original strand, 33860307 - 33860453
Alignment:
| Q |
33 |
acctataacatggttataaacaaaaatacatactataacatgtttagctttagtctttagtatataagattttcatctctcaattgaatttattatcact |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33860307 |
acctataacatggttataaacaaaaatacatactataacatgtttagctttagtctttagtatataagattttcatctctcaattgaatttattatcact |
33860406 |
T |
|
| Q |
133 |
tggtccaaatgaatgatgaaaattggaaatatgcaggtatgcaacag |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33860407 |
tggtccaaatgaatgatgaaaattggaaatatgcaggtatgcaacag |
33860453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 136 - 179
Target Start/End: Original strand, 33875288 - 33875331
Alignment:
| Q |
136 |
tccaaatgaatgatgaaaattggaaatatgcaggtatgcaacag |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33875288 |
tccaaatgaatgatgaaaattggaaatatgcaggtatgcaacag |
33875331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2706 times since January 2019
Visitors: 3823