View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0590_low_6 (Length: 364)
Name: NF0590_low_6
Description: NF0590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0590_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 1e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 103 - 283
Target Start/End: Original strand, 7445082 - 7445262
Alignment:
| Q |
103 |
ctttctctacttgtgtgtatgatggtgatcttcgtggacagatgcatggaccgaaaaggaaataaattgtgatataccaattaggttgtgttctgagttc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7445082 |
ctttctctacttgtgtgtatgatggtgatcttcgtggacagatgcatggaccgaaaaggaaataaattgtgatataccaattaggttgtgttctgagttc |
7445181 |
T |
 |
| Q |
203 |
tcacgttctcccacatgttctcaatcatgcacatattgctggaatcagattccccttccacttttattaattaatcaattc |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7445182 |
tcacgttctcccacatgttctcaatcatgcacatattgctggaatcagattccccttccacttttattaattaatcaattc |
7445262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University