View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0590_low_6 (Length: 364)

Name: NF0590_low_6
Description: NF0590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0590_low_6
NF0590_low_6
[»] chr4 (1 HSPs)
chr4 (103-283)||(7445082-7445262)


Alignment Details
Target: chr4 (Bit Score: 181; Significance: 1e-97; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 103 - 283
Target Start/End: Original strand, 7445082 - 7445262
Alignment:
103 ctttctctacttgtgtgtatgatggtgatcttcgtggacagatgcatggaccgaaaaggaaataaattgtgatataccaattaggttgtgttctgagttc 202  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7445082 ctttctctacttgtgtgtatgatggtgatcttcgtggacagatgcatggaccgaaaaggaaataaattgtgatataccaattaggttgtgttctgagttc 7445181  T
203 tcacgttctcccacatgttctcaatcatgcacatattgctggaatcagattccccttccacttttattaattaatcaattc 283  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7445182 tcacgttctcccacatgttctcaatcatgcacatattgctggaatcagattccccttccacttttattaattaatcaattc 7445262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 181 times since January 2019
Visitors: 3831